Conflicting Models For The Origin Of Life

Author : Stoyan K. Smoukov,Joseph Seckbach,Richard Gordon
Publisher : John Wiley & Sons
Page : 516 pages
File Size : 52,9 Mb
Release : 2023-03-21
Category : Science
ISBN : 9781119555520

Get Book

Conflicting Models for the Origin of Life by Stoyan K. Smoukov,Joseph Seckbach,Richard Gordon Pdf

Conflicting Models for the Origin of Life Conflicting Models for the Origin of Life provides a forum to compare and contrast the many hypotheses that have been put forward to explain the origin of life. There is a revolution brewing in the field of Origin of Life: in the process of trying to figure out how Life started, many researchers believe there is an impending second creation of life, not necessarily biological. Up-to-date understanding is needed to prepare us for the technological, and societal changes it would bring. Schrodinger’s 1944 “What is life?” included the insight of an information carrier, which inspired the discovery of the structure of DNA. In “Conflicting Models of the Origin of Life” a selection of the world’s experts are brought together to cover different aspects of the research: from progress towards synthetic life – artificial cells and sub-cellular components, to new definitions of life and the unexpected places life could (have) emerge(d). Chapters also cover fundamental questions of how memory could emerge from memoryless processes, and how we can tell if a molecule may have emerged from life. Similarly, cutting-edge research discusses plausible reactions for the emergence of life both on Earth and on exoplanets. Additional perspectives from geologists, philosophers and even roboticists thinking about the origin of life round out this volume. The text is a state-of-the-art snapshot of the latest developments on the emergence of life, to be used both in graduate classes and by citizen scientists. Audience Researchers in any area of astrobiology, as well as others interested in the origins of life, will find a modern and current review of the field and the current debates and obstacles. This book will clearly illustrate the current state-of-the-art and engage the imagination and creativity of experts across many disciplines.

Author : Pier Luigi Luisi
Publisher : Cambridge University Press
Page : 268 pages
File Size : 50,6 Mb
Release : 2006-07-13
Category : Science
ISBN : 9781139455640

Get Book

The Emergence of Life by Pier Luigi Luisi Pdf

The origin of life from inanimate matter has been the focus of much research for decades, both experimentally and philosophically. Luisi takes the reader through the consecutive stages from prebiotic chemistry to synthetic biology, uniquely combining both approaches. This book presents a systematic course discussing the successive stages of self-organisation, emergence, self-replication, autopoiesis, synthetic compartments and construction of cellular models, in order to demonstrate the spontaneous increase in complexity from inanimate matter to the first cellular life forms. A chapter is dedicated to each of these steps, using a number of synthetic and biological examples. With end-of-chapter review questions to aid reader comprehension, this book will appeal to graduate students and academics researching the origin of life and related areas such as evolutionary biology, biochemistry, molecular biology, biophysics and natural sciences.

Author : National Research Council,Division on Engineering and Physical Sciences,Space Studies Board,Committee on Planetary Biology and Chemical Evolution
Publisher : National Academies Press
Page : 161 pages
File Size : 53,8 Mb
Release : 1990-02-01
Category : Science
ISBN : 9780309042468

Get Book

The Search for Life's Origins by National Research Council,Division on Engineering and Physical Sciences,Space Studies Board,Committee on Planetary Biology and Chemical Evolution Pdf

The field of planetary biology and chemical evolution draws together experts in astronomy, paleobiology, biochemistry, and space science who work together to understand the evolution of living systems. This field has made exciting discoveries that shed light on how organic compounds came together to form self-replicating molecules-the origin of life. This volume updates that progress and offers recommendations on research programs-including an ambitious effort centered on Mars-to advance the field over the next 10 to 15 years. The book presents a wide range of data and research results on these and other issues: The biogenic elements and their interaction in the interstellar clouds and in solar nebulae. Early planetary environments and the conditions that lead to the origin of life. The evolution of cellular and multicellular life. The search for life outside the solar system. This volume will become required reading for anyone involved in the search for life's beginnings-including exobiologists, geoscientists, planetary scientists, and U.S. space and science policymakers.

Author : H. Charlton Bastian
Publisher : Unknown
Page : 216 pages
File Size : 44,5 Mb
Release : 1874
Category : Electronic books
ISBN : BSB:BSB11184414

Get Book

Evolution and the Origin of Life by H. Charlton Bastian Pdf

Author : John Maynard Smith,Eörs Szathmáry
Publisher : Oxford University Press, USA
Page : 200 pages
File Size : 50,9 Mb
Release : 1999
Category : Language Arts & Disciplines
ISBN : UOM:39015045659896

Get Book

The Origins of Life by John Maynard Smith,Eörs Szathmáry Pdf

To create this landmark work--a brilliant, state-of-the-art account of how life evolved on Earth--Smith and Szathmary have completely rewritten their "Major Transitions in Evolution" to bring their ideas to a wider audience of general readers. 42 illustrations.

Author : Freeman Dyson
Publisher : Cambridge University Press
Page : 114 pages
File Size : 51,9 Mb
Release : 1999-09-28
Category : Science
ISBN : 9781139425766

Get Book

Origins of Life by Freeman Dyson Pdf

How did life on earth originate? Did replication or metabolism come first in the history of life? In this book, Freeman Dyson examines these questions and discusses the two main theories that try to explain how naturally occurring chemicals could organize themselves into living creatures. The majority view is that life began with replicating molecules, the precursors of modern genes. The minority belief is that random populations of molecules evolved metabolic activities before exact replication existed. Dyson analyzes both of these theories with reference to recent important discoveries by geologists and chemists. His main aim is to stimulate experiments that could help to decide which theory is correct. This second edition covers the enormous advances that have been made in biology and geology in the past and the impact they have had on our ideas about how life began. It is a clearly-written, fascinating book that will appeal to anyone interested in the origins of life.

Author : John F. Ashton,John Ashton
Publisher : New Leaf Publishing Group
Page : 210 pages
File Size : 45,9 Mb
Release : 2012
Category : Nature
ISBN : 9780890516812

Get Book

Evolution Impossible by John F. Ashton,John Ashton Pdf

There is scientific evidence proving evolution cannot be responsible for life on Earth. In Evolution Impossible, Dr. John Ashton uses discoveries in genetics, biochemistry, geology, radiometric dating, and other scientific disciplines to explain why the theory of evolution is a myth. Regardless of your level of scientific education, you will finish this book able to cite 12 reasons why evolution cannot explain the origin of life.

Author : John Desmond Bernal
Publisher : Unknown
Page : 388 pages
File Size : 47,5 Mb
Release : 1967
Category : Evolution
ISBN : MINN:319510004678511

Get Book

The Origin of Life by John Desmond Bernal Pdf

Author : Stanley L. Miller,Leslie E. Orgel
Publisher : Prentice Hall
Page : 248 pages
File Size : 43,5 Mb
Release : 1974
Category : Biochemistry
ISBN : UCSD:31822013241377

Get Book

The Origins of Life on the Earth by Stanley L. Miller,Leslie E. Orgel Pdf

Author : Bryant M. Shiller
Publisher : Trafford on Demand Pub
Page : 521 pages
File Size : 46,7 Mb
Release : 2005-06
Category : Philosophy
ISBN : 1412027799

Get Book

Origin of Life by Bryant M. Shiller Pdf

The evidence suggests that the interactive system of biological Life we find on planet Earth originated here some 3.8 billion years ago. THE 5th OPTION asks the interesting (and provocative) questions that mainstream scientists ignore - such as: 1] What, exactly, is this phenomenon we call "biological life"? 2] What, exactly, is it doing here on our planet? 3] How did it get here? This is how an engineering mentality approaches the origin-of-life issues - from the "top down". Could this intricately intelligent evolving system we call "life" really have self-generated out of random lifeless chemical elements from scratch, as mainstream science (the 2nd Option) would have us believe? Don't count on it! THE 5th OPTION explores that possibility and concludes that the odds of it happening all by itself -without outside help - are virtually zero; the system of life on our planet was designed and implanted on our planet some 3.8 billion years ago purposefully and in order to accomplish specific goals. What possible purpose could be served? THE 5th OPTION engages in the novel process of reverse engineering the system of life on our planet in order to try to understand the phenomenon. Bryant Shiller, an engineer, puts himself "in the shoes of a would-be designer of the system of life" and asks the provocative question: "What would I - the hypothetical designer of the interactive system of life on planet Earth - have had in mind to have designed this planet wide system in this particular way? After all, system designers always have choices among various design alternatives and ultimately choose those that best serve the purpose-specific "design intent". This design intent is ultimately revealed. The author deals with these kinds of questions within his "5th Option" origin-of-life model entitled the "Rational Design Hypothesis (RDH)". The RDH homes in on the defining life-system attributes that lead unfailingly to: 1] a logical re-definition of the life phenomenon in terms of the laws of thermodynamics. 2] Life portrayed as an intelligent system based on a primary design platform (PdP) that epitomizes the cell as a product of nanotechnology. 3] the genetic code endowed with an intelligence scheme that must predate biology, and without which, biological activity cannot take place. A novel statistical analysis of the genetic code unveils its true nature as an effective non-random evolution filter. 4] the inclusion of a self-limiting feature within the life system design that has important consequences that threaten the future survival of the human species. The unexpected conclusions are nothing short of spectacular! Extraordinarily, the Rational Design Hypotheses is scientifically credible and relevant for one important reason: it is testable. Shiller defines where to find the evidence of design and how to access it. What does the RDH model have to say about the would-be designer? What are the unexpected consequences for human survival? The RDH model deals with both of these issues and much more. The results are eye opening and alarming! You will walk away from this exercise with a totally new appreciation of the meaning of life and the part you play in it.

Author : Kenji Ikehara
Publisher : Springer Nature
Page : 240 pages
File Size : 41,5 Mb
Release : 2021-06-07
Category : Science
ISBN : 9783030710873

Get Book

Towards Revealing the Origin of Life by Kenji Ikehara Pdf

The origin of life has been investigated by many researchers from various research fields, such as Geology, Geochemistry, Physics, Chemistry, Molecular Biology, Astronomy and so on. Nevertheless, the origin of life remains unsolved. One of the reasons for this could be attributed to the different approaches that researchers have used to understand the events that happened on the primitive Earth. The origins of the main three members of the fundamental life system, as gene, genetic code and protein, could be only separately understood with these approaches. Therefore, it is necessary to understand the origins of gene, the genetic code, tRNA, metabolism, cell structure and protein not separately but comprehensively under a common concept in order to understand the origin of life, because the six members are intimately related to each other. In this monograph, the author offers a comprehensive hypothesis to explain the origin of life under a common concept. At the same time, the author offers the [GADV] hypothesis contrasting it with other current hypotheses and discusses the results of analyses of genes/proteins and the experimental data available in the exploration of the current knowledge in the field. This book is of interest for science students, researchers and the general public interested in the origin of life.

Author : Adam Rutherford
Publisher : Penguin UK
Page : 272 pages
File Size : 49,6 Mb
Release : 2013-04-04
Category : Science
ISBN : 9780141970226

Get Book

Creation by Adam Rutherford Pdf

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Author : J. William Schopf
Publisher : Univ of California Press
Page : 220 pages
File Size : 52,9 Mb
Release : 2002
Category : Electronic books
ISBN : 0520233913

Get Book

Life's Origin by J. William Schopf Pdf

Author : Charles B. Thaxton,Walter L. Bradley,Roger L. Olsen
Publisher : Unknown
Page : 250 pages
File Size : 43,6 Mb
Release : 1984
Category : Science
ISBN : UOM:39015010075102

Get Book

The Mystery of Life's Origin by Charles B. Thaxton,Walter L. Bradley,Roger L. Olsen Pdf

Author : Iris Fry
Publisher : Rutgers University Press
Page : 348 pages
File Size : 44,5 Mb
Release : 2000
Category : Science
ISBN : 0813527406

Get Book

The Emergence of Life on Earth by Iris Fry Pdf

How did life emerge on Earth? Is there life on other worlds? These questions, until recently confined to the pages of speculative essays and tabloid headlines, are now the subject of legitimate scientific research. This book presents a unique perspective--a combined historical, scientific, and philosophical analysis, which does justice to the complex nature of the subject. The book's first part offers an overview of the main ideas on the origin of life as they developed from antiquity until the twentieth century. The second, more detailed part of the book examines contemporary theories and major debates within the origin-of-life scientific community. Topics include: Aristotle and the Greek atomists' conceptions of the organism Alexander Oparin and J.B.S. Haldane's 1920s breakthrough papers Possible life on Mars?