Origins Abiogenesis And The Search For Life Book in PDF, ePub and Kindle version is available to download in english. Read online anytime anywhere directly from your device. Click on the download button below to get a free pdf file of Origins Abiogenesis And The Search For Life book. This book definitely worth reading, it is an incredibly well-written.
National Research Council,Division on Engineering and Physical Sciences,Space Studies Board,Committee on Planetary Biology and Chemical Evolution
Author : National Research Council,Division on Engineering and Physical Sciences,Space Studies Board,Committee on Planetary Biology and Chemical Evolution Publisher : National Academies Press Page : 161 pages File Size : 44,6 Mb Release : 1990-02-01 Category : Science ISBN : 9780309042468
The Search for Life's Origins by National Research Council,Division on Engineering and Physical Sciences,Space Studies Board,Committee on Planetary Biology and Chemical Evolution Pdf
The field of planetary biology and chemical evolution draws together experts in astronomy, paleobiology, biochemistry, and space science who work together to understand the evolution of living systems. This field has made exciting discoveries that shed light on how organic compounds came together to form self-replicating molecules-the origin of life. This volume updates that progress and offers recommendations on research programs-including an ambitious effort centered on Mars-to advance the field over the next 10 to 15 years. The book presents a wide range of data and research results on these and other issues: The biogenic elements and their interaction in the interstellar clouds and in solar nebulae. Early planetary environments and the conditions that lead to the origin of life. The evolution of cellular and multicellular life. The search for life outside the solar system. This volume will become required reading for anyone involved in the search for life's beginnings-including exobiologists, geoscientists, planetary scientists, and U.S. space and science policymakers.
Origins, Abiogenesis and the Search for Life by Michael Russell Pdf
What is the origin of life? How did life begin? The question of life's origins has been asked for thousands of years and a variety of theories have been proposed. Yet, perhaps the right question has never been asked, which is, what does life do? To understand life, we must understand what it is, what it does, how it evolved from simple chemicals to self-replicating molecule, and then the questions of origins can be properly addressed. Did life begin in a deep sea thermal vent, or in an alkaline world? What were the role of viruses in kick starting life? Did life emerge from disequilibrium? What is the source of pre-genetic information? Did vesicles come first, or only after life had begun? In this text, over 20 of the world's leading scientists ask, and answer the hard questions, and in so doing may have ushered in a paradigm shift, and a scientific revolution in our understanding of the nature of life and its origins.
Origins of Life How Life Began Abiogenesis, Astrobiology by Nick Lane,Michael J. Russell,Earnest Di Mauro Pdf
How Did Life Begin? There are two scientific views on the origins of life: 1) Earthly-Abiogenesis which argues life on Earth began on Earth, and 2) Extraterrestrial Abiogenesis the position of which is life has an ancestry which predates the origins of Earth, and is pervasive throughout the cosmos. Thus, both theories embrace abiogenesis" and both argue that life may have begun on innumerable planets via the same mechanisms. In this ground-breaking, revolutionary text, over 30 top scientists from around the world, explain how life began and if there is life on other worlds, in over 20 paradigm busting chapters. PART I: Earthly Abiogenesis & the Origins of Life 1. Why Does Life Start, What Does It Do, Where Will It Be, And How Might We Find It? Michael J. Russell, Ph.D., and Isik Kanik, Ph.D., 2. Just Like the Universe the Emergence of Life had High Enthalpy and Low Entropy Beginnings, Wolfgang Nitschke, Ph.D., and Michael J. Russell, Ph.D. 3. Polyphosphate-Peptide Synergy and the Organic Takeover at the Emergence of Life. E. James Milner-White, Ph.D., and Michael J. Russell, Ph.D. 4. The Alkaline World and the Origin of Life. Anthony Richard Mellersh, Ph.D., and Paul Michael Smith, 5. Amino Acid Homochirality and the RNA World: Necessities for Life on Earth, Koji Tamura, Ph.D., 6. The RNA World and the Origin of Life: An Ancient Protein Fold Links Metal-Based Gas Reactions with the RNA World. Anne Volbeda, Ph.D., Yvain Nicolet, Ph.D., and Juan C. Fontecilla-Camps, Ph.D. 7. Evolutionary Steps to the Origin of Life on Earth. Andrew J. Pratt, D. Phil. 8. Vesicles First and the Origin of Self-Reproductive Life: Metabolic Energy, Replication, and Catalysis. Arthur L. Koch, Ph.D., 9. Chance or Necessity? Bioenergetics and the Probability of Life. Nick Lane, Ph.D. 10. Disequilibrium First: The Origin of Life Christof B. Mast, Ph.D., Natan Osterman, Ph.D., and Dieter Braun, Ph.D. 11. Life's Origins: Potential for Radical Mediated Cyanide Production on the Early Earth, Shawn E. McGlynn, Ph.D., Trevor E. Beard, Joan B. Broderick, Ph.D., and John W. Peters, Ph.D. 12. The Emergence of Life: Thermodynamics of Chemical Free Energy Generation in Off-Axis Hydrothermal Vent Systems & Consequences for Compartmentalization & Life's Origins. Eugenio Simoncini, Ph.D., Axel Kleidon, Ph.D., Enzo Gallori, Ph.D. 13. How Life Began: The Emergence of Sparse Metabolic Networks, Shelley D. Copley, Ph.D., Eric Smith, Ph.D., and Harold J. Morowitz, Ph.D., 14. Redox Homeostasis in the Emergence of Life. On the Constant Internal Environment of Nascent Living Cells, John F. Allen, Ph.D. 15. Reconstruction of the Molecular Origin of Life. Edward N. Trifonov, Ph.D., 16. How Primordial Cells Assembled Biosynthetic Pathways, Marco Fondi, Ph.D., Giovanni Emiliani, Ph.D., Renato Fani, Ph.D., 17. On the Emergence of Pre-Genetic Information. Ernesto Di Mauro, Ph.D., 18. Implications For An RNA-Clay World: Interaction Of Cytosine With Clay Minerals, A. Pucci, Ph.D., et al. 19. Viruses and Life: Can There Be One Without the Other? Matti Jalasvuori, Ph.D., and Jaana K.H. Bamford, Ph.D., 20. The Origin of Eukaryotes: Archae, Bacteria, Viruses and Horizontal Gene Transfer, R. Joseph, Ph.D. 21. What Can the Origin of Life on Earth Tell Us About the Cosmos? Stephen Freeland, Ph.D., and Gayle K. Philip, Ph.D. PART II: Extra-Terrestrial Abiogenesis 22. 1. Biological Cosmology and the Origins of Life in the Universe, R. Joseph, Ph.D., Rudolf Schild, Ph.D 23. First Life in the Oceans of Primordial-Planets: The Biological Big Bang. C.H. Gibson, Ph.D., N.C. Wickramasinghe, Ph.D., R.E. Schild, Ph.D 24. Genetics Indicates Extra-Terrestrial Origins of Life: the First Gene. R. Joseph, Ph.D., Rudolf Schild, Ph.D., N.C. Wickramasinghe, Ph.D.,
"I'll begin with a challenging question: Why should anyone want to know about the origin of life? The answers will vary from one person to the next, but the simplest answer is curiosity. Anyone reading this introduction is curious because they wonder how life could have begun on the Earth, but there is more to it than that. My friend Stuart Kauffman wrote a book with the title At Home in the Universe. The title refers to a deep sense of satisfaction that comes when we begin to understand how our lives on Earth are connected to the rest of the universe. There are surprises and revelations as we discover those connections"--
"The first part discusses the origins of everything, from the Big Bang to humankind. It follows the long course of evolution - from original matter to the formation of more complex structures, from the furthest galaxies to the nearest stars, from planets to organic molecules, from the first and most elementary forms of life through to the reptiles, the dinosaurs and the advent of man. The second part traces the history of the Earth and evaluates the risks of extinction in the future as predicted by scientists. Is the Earth the only habitable planet in the Universe? This question initiates the discussion on the importance of the Earth's position in the solar system and the significance of our geologically alive planet. The final part is dedicated to the search for extraterrestrial beings with identifiable life forms. It also describes attempts for searching, from the past to the near future." --Publisher's website.
The Origins of Life by John Maynard Smith,Eors Szathmary Pdf
In this fascinating book, John Maynard Smith and Eors Szathmary present an original picture of evolution. They propose that during evolution there have been a number of major transitions in the way in which information is passed between generations. These transitions include the appearance of the first replicating molecules, the emergence of co-operative animal societies, and the unique language ability of humans. Containing many new ideas, this book is contemporary biology on the grandest scale, from the birth of life to the origin of language.
Seven Clues to the Origin of Life by Alexander Graham Cairns-Smith Pdf
The mysteries surrounding the origins of life on earth are written in detective story fashion by a world famous scientist in this popular version of Genetic Takeover, originally published in 1982.
The origin of life from inanimate matter has been the focus of much research for decades, both experimentally and philosophically. Luisi takes the reader through the consecutive stages from prebiotic chemistry to synthetic biology, uniquely combining both approaches. This book presents a systematic course discussing the successive stages of self-organisation, emergence, self-replication, autopoiesis, synthetic compartments and construction of cellular models, in order to demonstrate the spontaneous increase in complexity from inanimate matter to the first cellular life forms. A chapter is dedicated to each of these steps, using a number of synthetic and biological examples. With end-of-chapter review questions to aid reader comprehension, this book will appeal to graduate students and academics researching the origin of life and related areas such as evolutionary biology, biochemistry, molecular biology, biophysics and natural sciences.
A New History of Life by Peter Ward,Joe Kirschvink Pdf
The history of life on Earth is, in some form or another, known to us all--or so we think. A New History of Life offers a provocative new account, based on the latest scientific research, of how life on our planet evolved--the first major new synthesis for general readers in two decades. Charles Darwin's theories, first published more than 150 years ago, form the backbone of how we understand the history of the Earth. In reality, the currently accepted history of life on Earth is so flawed, so out of date, that it's past time we need a 'New History of Life.' In their latest book, Joe Kirschvink and Peter Ward will show that many of our most cherished beliefs about the evolution of life are wrong. Gathering and analyzing years of discoveries and research not yet widely known to the public, A New History of Life proposes a different origin of species than the one Darwin proposed, one which includes eight-foot-long centipedes, a frozen “snowball Earth”, and the seeds for life originating on Mars. Drawing on their years of experience in paleontology, biology, chemistry, and astrobiology, experts Ward and Kirschvink paint a picture of the origins life on Earth that are at once too fabulous to imagine and too familiar to dismiss--and looking forward, A New History of Life brilliantly assembles insights from some of the latest scientific research to understand how life on Earth can and might evolve far into the future.
Between Necessity and Probability: Searching for the Definition and Origin of Life by Radu Popa Pdf
Systematically explores the early origins and basic definition of life. Investigates the major theories of the origins of life in light of modern research with the aim of distinguishing between the necessary and the optional and between deterministic and random influences in the emergence of what we call ‘life.’ Treats and views life as a cosmic phenomenon whose emergence and driving force should be viewed independently from its Earth-bound natural history. Synthesizes all the fundamental life-related developments in a comprehensive scenario, and makes the argument that understanding life in its broadest context requires a material-independent perspective that identifies its essential fingerprints
Astrobiology by Akihiko Yamagishi,Takeshi Kakegawa,Tomohiro Usui Pdf
This book provides concise and cutting-edge reviews in astrobiology, a young and still emerging multidisciplinary field of science that addresses the fundamental questions of how life originated and diversified on Earth, whether life exists beyond Earth, and what is the future for life on Earth. Readers will find coverage of the latest understanding of a wide range of fascinating topics, including, for example, solar system formation, the origins of life, the history of Earth as revealed by geology, the evolution of intelligence on Earth, the implications of genome data, insights from extremophile research, and the possible existence of life on other planets within and beyond the solar system. Each chapter contains a brief summary of the current status of the topic under discussion, sufficient references to enable more detailed study, and descriptions of recent findings and forthcoming missions or anticipated research. Written by leading experts in astronomy, planetary science, geoscience, chemistry, biology, and physics, this insightful and thought-provoking book will appeal to all students and scientists who are interested in life and space.
'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
